Lab technician

 How to design primers for PCR  Let's say you want to amplify this gene sequence with a PCR reaction :  5'-GGATCCCAGAGATACGGCTGATTACTCTTGTTGGTGTGGTATCGCTAAACTGCGCCGCGGAGCCTTATGGCAAAGTCGTCCGCGAACCATTCCGGTAGCGCTTAAGGTCCATAGCACATTCATCGCATCCCGGCGTGCGTTCAATTTGACGACCCCTTGGCGCAAAGGTGCTGGCCACGTGCTAAATTAAAGCGGCTGCACTGCTGTGAGAATTC-3' Things to consider before designing the primers:  Length of 18-24 bases  Melting temperature (Tm) of 50-60°C  Primer pairs should have similar Tm  Primer pairs should not have complementary regions How does the forward primer look like?  The forward primer starts at 5'-end and is identical to the first 18-24 base pairs:  Forward Primer : 5’-GGATCCCAGAGATACGGCTGATTACT–3’ How does the reverse primer look like?  The reverse primer starts at the 3'-end and extends to the 5'-end 18-24 base pairs in an antiparallel complimentary fashion :  Reverse Primer : 5’GAATTCTCACAGCAGTGCAGCCGCTTTAAT–3’ How to calculate the ann...

  Equal sample loading of protein samples Protocol    Take 20 µl protein sample and mix with 6.66 µl of 4x reducing buffer ( laemmli buffer )  Should be adjusted to your desired volume (general formular: V/3 if reducing buffer is 4x) Vortex the samples  Heat at 95° C for 5-10 min  Centrifuge samples  Load samples and marker on gel   Stack gel for 15 min at 90 Volts  Separate samples for 45 min - 1 hour at 130 - 150 Volts   Put gel into G250 Coomassie and incubate over night on a shaker  You can also heat the gel in a microwave until it cooks and stain for 1 hour (to stain fast)  Next day remove Coomassie and add destain solution   Destain several rounds until protein bands appear  Destaining can be improved by heating the gel in microwave  Analyse gel  Recipes:  G-250 Coomassie:   Chemical                     Fi...

How to make agarose gels for DNA separation  Protocol for 1% agarose gel   Weigh in 1g of agarose in an erlenmeyer flask or glass bottle Add 99 ml of 1x TAE buffer   Heat in microwave until the agarose dissolves completely (shake)  Cool down agarose with tap water until flask can be touched with bear hands  Add DNA dye (for example midori green by Nippon Genetics ) 1:1000 e.g. 1µl; shake  Pour gel into gel chamber   Let solidify for 30 min at RT  Take gel, place into agarose gel electrophoresis chamber , remove comb gently  Add 1x TAE buffer and cover gel with buffer completely, make sure that slots are filled with buffer  Prepare DNA samples: For example if you have 20 µl of sample, add 4 µl of 6x loading dye   Load DNA marker ( GeneRuler 1kb 0.5µg/µl  by Thermo Fisher ) and samples into gel slots  Run the gel at 90 Volts for 45 min to 1 hour.  Analyse DNA under UV light or imager   50x TAE Buffer : ...