How to design primers for PCR

-

 How to design primers for PCR 



Let's say you want to amplify this gene sequence with a PCR reaction: 

5'-GGATCCCAGAGATACGGCTGATTACTCTTGTTGGTGTGGTATCGCTAAACTGCGCCGCGGAGCCTTATGGCAAAGTCGTCCGCGAACCATTCCGGTAGCGCTTAAGGTCCATAGCACATTCATCGCATCCCGGCGTGCGTTCAATTTGACGACCCCTTGGCGCAAAGGTGCTGGCCACGTGCTAAATTAAAGCGGCTGCACTGCTGTGAGAATTC-3'

Things to consider before designing the primers: 

How does the forward primer look like? 

The forward primer starts at 5'-end and is identical to the first 18-24 base pairs: 

Forward Primer: 5’-GGATCCCAGAGATACGGCTGATTACT–3’

How does the reverse primer look like? 

The reverse primer starts at the 3'-end and extends to the 5'-end 18-24 base pairs in an antiparallel complimentary fashion: 

Reverse Primer: 5’GAATTCTCACAGCAGTGCAGCCGCTTTAAT–3’

How to calculate the annealing temperature (Tm) for your primer pair? 

Adjust the Tm for both primers using free software such as Serial Cloner by adding or subtracting bases from the 3'-end of the primers. Based on the polymerase and primer concentration find a Tm calculator online for your polymerase and insert your primer sequences. The online calculator will provide you with the best Tm for your primers and polymerase. If you have troubles with Tm you can also set a gradient PCR with varying Tm's to test the perfect temperature. 





Comments

Post a Comment

Popular posts from this blog

Western blot (SDS–PAGE → semi-dry transfer → immunodetection) — step-by-step protocol

-
Image
Western blot (SDS–PAGE → semi-dry transfer → immunodetection) — step-by-step protocol Overview:  Western blotting ( Immuno-Blotting ) is a technique which allows to detect specific proteins ( antigens ) via the interaction with a corresponding antibody . Therefore, proteins which were first separated by their molar mass on a polyacrylamide gel are transferred to a nitrocellulose or polyvinylidenfluorid   ( PVDF ) membrane by applying an electric field. The membrane is then exposed to a primary antibody solution where the antibody binds solely to the desired protein. Next, the membrane is incubated with a secondary antibody which subsequently binds to the first antibody. The secondary antibody carries an enzyme which catalysis a chemical reaction when exposed to a detection solution resulting in a fluorescent signal that can be measured. Western blotting allows to detect protein amounts below the nanogram level Material and Chemicals you will need:   Rotib...
Read more

G250 Staining and Equal Sample Loading of Protein Samples

-
Image
  Equal sample loading of protein samples Protocol    Take 20 µl protein sample and mix with 6.66 µl of 4x reducing buffer ( laemmli buffer )  Should be adjusted to your desired volume (general formular: V/3 if reducing buffer is 4x) Vortex the samples  Heat at 95° C for 5-10 min  Centrifuge samples  Load samples and marker on gel   Stack gel for 15 min at 90 Volts  Separate samples for 45 min - 1 hour at 130 - 150 Volts   Put gel into G250 Coomassie and incubate over night on a shaker  You can also heat the gel in a microwave until it cooks and stain for 1 hour (to stain fast)  Next day remove Coomassie and add destain solution   Destain several rounds until protein bands appear  Destaining can be improved by heating the gel in microwave  Analyse gel  Recipes:  G-250 Coomassie:   Chemical                     Fi...
Read more

Stripping of Westernblot membranes

-
Image
  Stripping of WB membranes protocol -          Prewarm stripping box for 10 min. in 55 °C water bath with 100 mL stripping buffer + 680  µ L  β -Mercaptoethanol (alternatively you can use 50 ml with 340 µl) -          Put membrane in stripping buffer box in water bath for 20 minutes, after incubation pour stripping buffer in  β -Mercaptoethanol waste -          Wash 1x with distilled water; add water and let it incubate without shaking to evaporate  β -Mercaptoethanol -          Transfer membranes into new box with TBST buffer -          Wash on shaker for 10 minutes 3x with TBST buffer  -          Prepare next antibody  -          Put in tubes with new antibody (no extra b...
Read more