How to design primers for PCR

 How to design primers for PCR 



Let's say you want to amplify this gene sequence with a PCR reaction

5'-GGATCCCAGAGATACGGCTGATTACTCTTGTTGGTGTGGTATCGCTAAACTGCGCCGCGGAGCCTTATGGCAAAGTCGTCCGCGAACCATTCCGGTAGCGCTTAAGGTCCATAGCACATTCATCGCATCCCGGCGTGCGTTCAATTTGACGACCCCTTGGCGCAAAGGTGCTGGCCACGTGCTAAATTAAAGCGGCTGCACTGCTGTGAGAATTC-3'

Things to consider before designing the primers: 

How does the forward primer look like? 

The forward primer starts at 5'-end and is identical to the first 18-24 base pairs: 

Forward Primer: 5’-GGATCCCAGAGATACGGCTGATTACT–3’

How does the reverse primer look like? 

The reverse primer starts at the 3'-end and extends to the 5'-end 18-24 base pairs in an antiparallel complimentary fashion

Reverse Primer: 5’GAATTCTCACAGCAGTGCAGCCGCTTTAAT–3’

How to calculate the annealing temperature (Tm) for your primer pair? 

Adjust the Tm for both primers using free software such as Serial Cloner by adding or subtracting bases from the 3'-end of the primers. Based on the polymerase and primer concentration find a Tm calculator online for your polymerase and insert your primer sequences. The online calculator will provide you with the best Tm for your primers and polymerase. If you have troubles with Tm you can also set a gradient PCR with varying Tm's to test the perfect temperature. 





Comments